rnaseqCounts.Rd
This function executes a set of docker containers allowing the generation of gene and isoforms counts for a single sample. #params skewer
rnaseqCounts( group = "sudo", fastq.folder = getwd(), scratch.folder = "/data/scratch", threads = 4, adapter5, adapter3, seq.type = "pe", min.length = 40, genome.folder = "/data/genomes/hg38star", strandness = "none", save.bam = TRUE, org = "hg38", annotation.type = "gtfENSEMBL" )
group, | a character string. Two options: |
---|---|
fastq.folder, | a character string indicating where gzip fastq files are located |
scratch.folder, | a character string indicating the scratch folder where docker container will be mounted |
threads, | a number indicating the number of cores to be used from the application |
adapter5, | a character string indicating the fwd adapter |
adapter3, | a character string indicating the rev adapter |
seq.type, | a character string indicating the type of reads to be generated by the sequencer. Two options: |
min.length, | a number indicating minimal length required to return a trimmed read #params rsemstar |
genome.folder, | a character string indicating the folder where the indexed reference genome is located. IMPORTANT the present function only suport genomic indexes made using ensembl genom and the corresponding gtf |
strandness, | a character string indicating the type ofsequencing protocol used for the analysis. Three options: |
save.bam, | a boolean value, TRUE or FALSE, to save also BAM files generated by STAR and RSEM #params rsemanno |
org, | a character string indicating the genome assembly used for mapping and counting with |
annotation.type, | a character string. Two options: |
Returns the output of skewer, rsemstar, rsemannos' functions
if (FALSE) { system("wget http://130.192.119.59/public/test_R1.fastq.gz") library(docker4seq) rnaseqCounts(group="docker",fastq.folder=getwd(), scratch.folder="/data/scratch/", adapter5="AGATCGGAAGAGCACACGTCTGAACTCCAGTCA", adapter3="AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", seq.type="se", threads=24, min.length=40, genome.folder="/data/genomes/hg38star", strandness="none", save.bam=FALSE, org="hg38", annotation.type="gtfENSEMBL") }