salmonCounts.RdThis function executes a docker that produces as output the transcripts count file generated by Salmon quasi-alignment
a character string. Two options: sudo or docker, depending to which group the user belongs
a character string indicating the path of the scratch folder
a character string indicating the folder where input data are located and where output will be written
a character string indicating the folder where transcriptome index was created with salmonIndex.
a number indicating the number of cores to be used from the application
a character string indicating the type of reads to be generated by the sequencer. Two options: "se" or "pe" respectively for single end and pair end sequencing. Strandness is inferred by salmon.
a character string indicating the type ofsequencing protocol used for the analysis. Three options: "none", "forward", "reverse" respectively for non strand selection, reverse for Illumina strandness protocols, reverse for ACCESS Illumina protocol
if (FALSE) {
system("wget http://130.192.119.59/public/test_R1.fastq.gz")
system("wget http://130.192.119.59/public/test_R2.fastq.gz")
library(docker4seq)
wrapperSalmon(group="docker", scratch.folder="/data/scratch/",
fastq.folder=getwd(), index.folder="/data/genomes/hg38salmon",
threads=24, seq.type="pe", adapter5="AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
adapter3="AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT", min.length=40, strandness="none")
}